Poster Reprint ASMS 2025 Poster number ThP 565 High-throughput Ion-Pairing Free Reversed Phase Analysis of Oligonucleotides using RapidFire Quadrupole Time-of-Flight Mass Spectrometry Guannan Li and Lee Bertram Agilent Technologies, Inc., Santa Clara, CA Introduction Experimental Oligonucleotides are commonly analyzed by…
Key words
givosiren, aso, oligos, fomivirsen, antisense, sense, oligo, agca, agcatgcatacaagaatgaatacatgca, catgcatgcatgcatgcatgcatgcatg, mcfamgfamgfumamgfa, mgfumcfumufufcmufcfa, mgmamamafgmafgmufg, tgcatgcatgca, tgcatgcatgcatgaatgcatgcataca